90
|
Logitech Inc
wireless mouse Wireless Mouse, supplied by Logitech Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wireless mouse/product/Logitech Inc Average 90 stars, based on 1 article reviews
wireless mouse - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Woodstream Corporation
victor® snap trap m325 m7 pro mouse Victor® Snap Trap M325 M7 Pro Mouse, supplied by Woodstream Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/victor® snap trap m325 m7 pro mouse/product/Woodstream Corporation Average 90 stars, based on 1 article reviews
victor® snap trap m325 m7 pro mouse - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
N/A
|
Herpes simplex Virus 1 HSV1 Glycoprotein D mouse monoclonal antibody clone 1 I 9 Purified
|
Buy from Supplier |
N/A
|
HCV Core protein 1 80 mouse monoclonal antibody clone 6A1 Biotin
|
Buy from Supplier |
N/A
|
mouse monoclonal antibody clone I K 10 Purified
|
Buy from Supplier |
N/A
|
MicroRNA: mmu-miR-7049-3p Accession Number: MIMAT0028003 Mature Sequence: UGCAGCCCCUGUCUGCCUCAG mmu-miR-7049-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |
N/A
|
HCV Core protein 80 160 mouse monoclonal antibody clone 7A1 Purified
|
Buy from Supplier |
N/A
|
Carbamazepine mouse monoclonal antibody clone CA1 Purified
|
Buy from Supplier |
N/A
|
HCV NS4 mouse monoclonal antibody clone 8A1 Purified
|
Buy from Supplier |
N/A
|
Hairpin precursor miRNA of approximately 150 nucleotides is cloned into lentiviral or non-viral vectors for delivery in virtually all cell types.
|
Buy from Supplier |
N/A
|
HIV 1 Gag Matrix protein p17 mouse monoclonal antibody clone 4A1 Purified
|
Buy from Supplier |